Review



rabbit anti oct4  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Proteintech rabbit anti oct4
    Rabbit Anti Oct4, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti-oct4/HRP-conjugated+OCT4+Antibody/pm41814669-88-35-37
    Average 94 stars, based on 4 article reviews
    rabbit anti oct4 - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Immunocytochemistry:

    Article Title: Generation of a homozygous CRISPR/Cas9-mediated knockout human iPSC line for the STUB1 locus.
    Article Snippet: Antibodies used for immunocytochemistry and Western Blotting Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 1:100 Proteintech, AB_2167545 Millipore, AB_177638 Mouse anti-TRA1–81 1:500 In vitro Differentiation Mouse anti-SMA 1:100 Dako, AB_2223500 R&D Systems, AB_355060 goat anti-SOX17 1:250 rabbit anti-FOX-A2 1:300 Millipore, AB_390153 Sigma Aldrich, AB_477590 mouse anti-TUJ 1:1000 Western Blotting Rabbit anti-CHIP 1:10.000 Abcam, AB_2751008 Meridian Life Science, AB_151542 Mouse anti-GAPDH 1:10.000 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG 1:1000 Life Technologies Alexa Fluor 488 Goat anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 488 Donkey anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 568 Donkey anti-Goat IgG 1:1000 Life Technologies Peroxidase-conjugated AffiniPure goat anti mouse 1:10.000 Jackson ImmunoResearch Peroxidase-conjugated AffiniPure goat anti-rabbit 1:10.000 Jackson ImmunoResearch Primers Target Forward primer Reverse primer (5′-3′) Episomal Plasmids KLF4 CCACCTCGCCTTACACATGAAG TAGCGTAAAAGGAGCAACATAG L-MYC GGCTGAGAAGAGGATGGCTAC TTTGTTTGACAGGAGCGACAAT OCT3/4 CATTCAAACTGAGGTAAGGG TAGCGTAAAAGGAGCAACATAG SOX2 TTCACATGTCCCAGCACTACCAG TTTGTTTGACAGGAGCGACAAT Pluripotency Markers (qPCR) c-MYC GACTCTGAGGAGGAACAAGA TGATCCAGACTCTGACCTTT DNMT3B GAGTATCAGGATGGGAAGGA ATAGCCTGTCGCTTGGA KLF4 CCATCTTTCTCCACGTTCGC CGTTGAACTCCTCGGTCTCT NANOG CAAAGGCAAACAACCCACTT TGCGTCACACCATTGCTATT OCT4 GGAAGGTATTCAGCCAAACG CTCCAGGTTGCCTCTCACTC SOX2 TGATGGAGACGGAGCTGAAG GCTTGCTGATCTCCGAGTTG TDGF1 GGTCTGTGCCCCATGACA AGTTCTGGAGTCCTGGAAGC Housekeeping Gene (qPCR) GAPDH AGGTCGGAGTCAACGGATTT ATCTCGCTCCTGGAAGATGG Targeted sequencing of CHIP KO CHIP TGATTCTAGCCAGAGCGCAG TCGGGAGTCGGTGATTCAGA CRISPR Guide RNAs Target Sequence PAM Sequence crRNAs CHIP exon 2 GCTGGACGGGCAGTCTGTGA AGG CHIP exon 3 GAATCGCGAAGAAGAAGCGC TGG

    Article Title: Generation of two SPAST knockout human induced pluripotent stem cell lines to create a model for Hereditary Spastic Paraplegia type 4.
    Article Snippet: Antibodies and stains used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 Mouse anti-TRA1-81 1:100 1:500 Proteintech AB_2167545 Millipore AB_177638 Differentiation Markers Mouse anti-SMA Goat anti-SOX17 Rabbit anti-FOXA2 Mouse anti-TUJ 1:100 1:250 1:300 1:1000 Dako, AB_2223500 R&D Systems, AB_355060 Millipore, AB_390153 Sigma Aldrich, AB_477590 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG Alexa Fluor 488 Goat anti-Rabbit IgG Alexa Fluor 488 Donkey anti-Goat IgG Alexa Fluor 568 Mouse anti-Rabbit IgG 1:1000 1:1000 1:1000 1:1000 Life Technologies Life Technologies Life Technologies Life Technologies Nuclear stain DAPI 1 μg/ml ThermoFisher Scientific cat #D1306 Site-specific nuclease Nuclease information Alt-RTM S.p.

    Staining:

    Article Title: Generation of a homozygous CRISPR/Cas9-mediated knockout human iPSC line for the STUB1 locus.
    Article Snippet: Antibodies used for immunocytochemistry and Western Blotting Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 1:100 Proteintech, AB_2167545 Millipore, AB_177638 Mouse anti-TRA1–81 1:500 In vitro Differentiation Mouse anti-SMA 1:100 Dako, AB_2223500 R&D Systems, AB_355060 goat anti-SOX17 1:250 rabbit anti-FOX-A2 1:300 Millipore, AB_390153 Sigma Aldrich, AB_477590 mouse anti-TUJ 1:1000 Western Blotting Rabbit anti-CHIP 1:10.000 Abcam, AB_2751008 Meridian Life Science, AB_151542 Mouse anti-GAPDH 1:10.000 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG 1:1000 Life Technologies Alexa Fluor 488 Goat anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 488 Donkey anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 568 Donkey anti-Goat IgG 1:1000 Life Technologies Peroxidase-conjugated AffiniPure goat anti mouse 1:10.000 Jackson ImmunoResearch Peroxidase-conjugated AffiniPure goat anti-rabbit 1:10.000 Jackson ImmunoResearch Primers Target Forward primer Reverse primer (5′-3′) Episomal Plasmids KLF4 CCACCTCGCCTTACACATGAAG TAGCGTAAAAGGAGCAACATAG L-MYC GGCTGAGAAGAGGATGGCTAC TTTGTTTGACAGGAGCGACAAT OCT3/4 CATTCAAACTGAGGTAAGGG TAGCGTAAAAGGAGCAACATAG SOX2 TTCACATGTCCCAGCACTACCAG TTTGTTTGACAGGAGCGACAAT Pluripotency Markers (qPCR) c-MYC GACTCTGAGGAGGAACAAGA TGATCCAGACTCTGACCTTT DNMT3B GAGTATCAGGATGGGAAGGA ATAGCCTGTCGCTTGGA KLF4 CCATCTTTCTCCACGTTCGC CGTTGAACTCCTCGGTCTCT NANOG CAAAGGCAAACAACCCACTT TGCGTCACACCATTGCTATT OCT4 GGAAGGTATTCAGCCAAACG CTCCAGGTTGCCTCTCACTC SOX2 TGATGGAGACGGAGCTGAAG GCTTGCTGATCTCCGAGTTG TDGF1 GGTCTGTGCCCCATGACA AGTTCTGGAGTCCTGGAAGC Housekeeping Gene (qPCR) GAPDH AGGTCGGAGTCAACGGATTT ATCTCGCTCCTGGAAGATGG Targeted sequencing of CHIP KO CHIP TGATTCTAGCCAGAGCGCAG TCGGGAGTCGGTGATTCAGA CRISPR Guide RNAs Target Sequence PAM Sequence crRNAs CHIP exon 2 GCTGGACGGGCAGTCTGTGA AGG CHIP exon 3 GAATCGCGAAGAAGAAGCGC TGG

    Article Title: Generation of two SPAST knockout human induced pluripotent stem cell lines to create a model for Hereditary Spastic Paraplegia type 4.
    Article Snippet: Antibodies and stains used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 Mouse anti-TRA1-81 1:100 1:500 Proteintech AB_2167545 Millipore AB_177638 Differentiation Markers Mouse anti-SMA Goat anti-SOX17 Rabbit anti-FOXA2 Mouse anti-TUJ 1:100 1:250 1:300 1:1000 Dako, AB_2223500 R&D Systems, AB_355060 Millipore, AB_390153 Sigma Aldrich, AB_477590 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG Alexa Fluor 488 Goat anti-Rabbit IgG Alexa Fluor 488 Donkey anti-Goat IgG Alexa Fluor 568 Mouse anti-Rabbit IgG 1:1000 1:1000 1:1000 1:1000 Life Technologies Life Technologies Life Technologies Life Technologies Nuclear stain DAPI 1 μg/ml ThermoFisher Scientific cat #D1306 Site-specific nuclease Nuclease information Alt-RTM S.p.

    Western Blot:

    Article Title: Generation of a homozygous CRISPR/Cas9-mediated knockout human iPSC line for the STUB1 locus.
    Article Snippet: Antibodies used for immunocytochemistry and Western Blotting Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 1:100 Proteintech, AB_2167545 Millipore, AB_177638 Mouse anti-TRA1–81 1:500 In vitro Differentiation Mouse anti-SMA 1:100 Dako, AB_2223500 R&D Systems, AB_355060 goat anti-SOX17 1:250 rabbit anti-FOX-A2 1:300 Millipore, AB_390153 Sigma Aldrich, AB_477590 mouse anti-TUJ 1:1000 Western Blotting Rabbit anti-CHIP 1:10.000 Abcam, AB_2751008 Meridian Life Science, AB_151542 Mouse anti-GAPDH 1:10.000 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG 1:1000 Life Technologies Alexa Fluor 488 Goat anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 488 Donkey anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 568 Donkey anti-Goat IgG 1:1000 Life Technologies Peroxidase-conjugated AffiniPure goat anti mouse 1:10.000 Jackson ImmunoResearch Peroxidase-conjugated AffiniPure goat anti-rabbit 1:10.000 Jackson ImmunoResearch Primers Target Forward primer Reverse primer (5′-3′) Episomal Plasmids KLF4 CCACCTCGCCTTACACATGAAG TAGCGTAAAAGGAGCAACATAG L-MYC GGCTGAGAAGAGGATGGCTAC TTTGTTTGACAGGAGCGACAAT OCT3/4 CATTCAAACTGAGGTAAGGG TAGCGTAAAAGGAGCAACATAG SOX2 TTCACATGTCCCAGCACTACCAG TTTGTTTGACAGGAGCGACAAT Pluripotency Markers (qPCR) c-MYC GACTCTGAGGAGGAACAAGA TGATCCAGACTCTGACCTTT DNMT3B GAGTATCAGGATGGGAAGGA ATAGCCTGTCGCTTGGA KLF4 CCATCTTTCTCCACGTTCGC CGTTGAACTCCTCGGTCTCT NANOG CAAAGGCAAACAACCCACTT TGCGTCACACCATTGCTATT OCT4 GGAAGGTATTCAGCCAAACG CTCCAGGTTGCCTCTCACTC SOX2 TGATGGAGACGGAGCTGAAG GCTTGCTGATCTCCGAGTTG TDGF1 GGTCTGTGCCCCATGACA AGTTCTGGAGTCCTGGAAGC Housekeeping Gene (qPCR) GAPDH AGGTCGGAGTCAACGGATTT ATCTCGCTCCTGGAAGATGG Targeted sequencing of CHIP KO CHIP TGATTCTAGCCAGAGCGCAG TCGGGAGTCGGTGATTCAGA CRISPR Guide RNAs Target Sequence PAM Sequence crRNAs CHIP exon 2 GCTGGACGGGCAGTCTGTGA AGG CHIP exon 3 GAATCGCGAAGAAGAAGCGC TGG

    Article Title: Generation of two SPAST knockout human induced pluripotent stem cell lines to create a model for Hereditary Spastic Paraplegia type 4.
    Article Snippet: Antibodies and stains used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 Mouse anti-TRA1-81 1:100 1:500 Proteintech AB_2167545 Millipore AB_177638 Differentiation Markers Mouse anti-SMA Goat anti-SOX17 Rabbit anti-FOXA2 Mouse anti-TUJ 1:100 1:250 1:300 1:1000 Dako, AB_2223500 R&D Systems, AB_355060 Millipore, AB_390153 Sigma Aldrich, AB_477590 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG Alexa Fluor 488 Goat anti-Rabbit IgG Alexa Fluor 488 Donkey anti-Goat IgG Alexa Fluor 568 Mouse anti-Rabbit IgG 1:1000 1:1000 1:1000 1:1000 Life Technologies Life Technologies Life Technologies Life Technologies Nuclear stain DAPI 1 μg/ml ThermoFisher Scientific cat #D1306 Site-specific nuclease Nuclease information Alt-RTM S.p.

    In Vitro:

    Article Title: Generation of a homozygous CRISPR/Cas9-mediated knockout human iPSC line for the STUB1 locus.
    Article Snippet: Antibodies used for immunocytochemistry and Western Blotting Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 1:100 Proteintech, AB_2167545 Millipore, AB_177638 Mouse anti-TRA1–81 1:500 In vitro Differentiation Mouse anti-SMA 1:100 Dako, AB_2223500 R&D Systems, AB_355060 goat anti-SOX17 1:250 rabbit anti-FOX-A2 1:300 Millipore, AB_390153 Sigma Aldrich, AB_477590 mouse anti-TUJ 1:1000 Western Blotting Rabbit anti-CHIP 1:10.000 Abcam, AB_2751008 Meridian Life Science, AB_151542 Mouse anti-GAPDH 1:10.000 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG 1:1000 Life Technologies Alexa Fluor 488 Goat anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 488 Donkey anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 568 Donkey anti-Goat IgG 1:1000 Life Technologies Peroxidase-conjugated AffiniPure goat anti mouse 1:10.000 Jackson ImmunoResearch Peroxidase-conjugated AffiniPure goat anti-rabbit 1:10.000 Jackson ImmunoResearch Primers Target Forward primer Reverse primer (5′-3′) Episomal Plasmids KLF4 CCACCTCGCCTTACACATGAAG TAGCGTAAAAGGAGCAACATAG L-MYC GGCTGAGAAGAGGATGGCTAC TTTGTTTGACAGGAGCGACAAT OCT3/4 CATTCAAACTGAGGTAAGGG TAGCGTAAAAGGAGCAACATAG SOX2 TTCACATGTCCCAGCACTACCAG TTTGTTTGACAGGAGCGACAAT Pluripotency Markers (qPCR) c-MYC GACTCTGAGGAGGAACAAGA TGATCCAGACTCTGACCTTT DNMT3B GAGTATCAGGATGGGAAGGA ATAGCCTGTCGCTTGGA KLF4 CCATCTTTCTCCACGTTCGC CGTTGAACTCCTCGGTCTCT NANOG CAAAGGCAAACAACCCACTT TGCGTCACACCATTGCTATT OCT4 GGAAGGTATTCAGCCAAACG CTCCAGGTTGCCTCTCACTC SOX2 TGATGGAGACGGAGCTGAAG GCTTGCTGATCTCCGAGTTG TDGF1 GGTCTGTGCCCCATGACA AGTTCTGGAGTCCTGGAAGC Housekeeping Gene (qPCR) GAPDH AGGTCGGAGTCAACGGATTT ATCTCGCTCCTGGAAGATGG Targeted sequencing of CHIP KO CHIP TGATTCTAGCCAGAGCGCAG TCGGGAGTCGGTGATTCAGA CRISPR Guide RNAs Target Sequence PAM Sequence crRNAs CHIP exon 2 GCTGGACGGGCAGTCTGTGA AGG CHIP exon 3 GAATCGCGAAGAAGAAGCGC TGG

    Article Title: Generation of two SPAST knockout human induced pluripotent stem cell lines to create a model for Hereditary Spastic Paraplegia type 4.
    Article Snippet: Antibodies and stains used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 Mouse anti-TRA1-81 1:100 1:500 Proteintech AB_2167545 Millipore AB_177638 Differentiation Markers Mouse anti-SMA Goat anti-SOX17 Rabbit anti-FOXA2 Mouse anti-TUJ 1:100 1:250 1:300 1:1000 Dako, AB_2223500 R&D Systems, AB_355060 Millipore, AB_390153 Sigma Aldrich, AB_477590 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG Alexa Fluor 488 Goat anti-Rabbit IgG Alexa Fluor 488 Donkey anti-Goat IgG Alexa Fluor 568 Mouse anti-Rabbit IgG 1:1000 1:1000 1:1000 1:1000 Life Technologies Life Technologies Life Technologies Life Technologies Nuclear stain DAPI 1 μg/ml ThermoFisher Scientific cat #D1306 Site-specific nuclease Nuclease information Alt-RTM S.p.

    Real-time Polymerase Chain Reaction:

    Article Title: Generation of a homozygous CRISPR/Cas9-mediated knockout human iPSC line for the STUB1 locus.
    Article Snippet: Antibodies used for immunocytochemistry and Western Blotting Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 1:100 Proteintech, AB_2167545 Millipore, AB_177638 Mouse anti-TRA1–81 1:500 In vitro Differentiation Mouse anti-SMA 1:100 Dako, AB_2223500 R&D Systems, AB_355060 goat anti-SOX17 1:250 rabbit anti-FOX-A2 1:300 Millipore, AB_390153 Sigma Aldrich, AB_477590 mouse anti-TUJ 1:1000 Western Blotting Rabbit anti-CHIP 1:10.000 Abcam, AB_2751008 Meridian Life Science, AB_151542 Mouse anti-GAPDH 1:10.000 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG 1:1000 Life Technologies Alexa Fluor 488 Goat anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 488 Donkey anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 568 Donkey anti-Goat IgG 1:1000 Life Technologies Peroxidase-conjugated AffiniPure goat anti mouse 1:10.000 Jackson ImmunoResearch Peroxidase-conjugated AffiniPure goat anti-rabbit 1:10.000 Jackson ImmunoResearch Primers Target Forward primer Reverse primer (5′-3′) Episomal Plasmids KLF4 CCACCTCGCCTTACACATGAAG TAGCGTAAAAGGAGCAACATAG L-MYC GGCTGAGAAGAGGATGGCTAC TTTGTTTGACAGGAGCGACAAT OCT3/4 CATTCAAACTGAGGTAAGGG TAGCGTAAAAGGAGCAACATAG SOX2 TTCACATGTCCCAGCACTACCAG TTTGTTTGACAGGAGCGACAAT Pluripotency Markers (qPCR) c-MYC GACTCTGAGGAGGAACAAGA TGATCCAGACTCTGACCTTT DNMT3B GAGTATCAGGATGGGAAGGA ATAGCCTGTCGCTTGGA KLF4 CCATCTTTCTCCACGTTCGC CGTTGAACTCCTCGGTCTCT NANOG CAAAGGCAAACAACCCACTT TGCGTCACACCATTGCTATT OCT4 GGAAGGTATTCAGCCAAACG CTCCAGGTTGCCTCTCACTC SOX2 TGATGGAGACGGAGCTGAAG GCTTGCTGATCTCCGAGTTG TDGF1 GGTCTGTGCCCCATGACA AGTTCTGGAGTCCTGGAAGC Housekeeping Gene (qPCR) GAPDH AGGTCGGAGTCAACGGATTT ATCTCGCTCCTGGAAGATGG Targeted sequencing of CHIP KO CHIP TGATTCTAGCCAGAGCGCAG TCGGGAGTCGGTGATTCAGA CRISPR Guide RNAs Target Sequence PAM Sequence crRNAs CHIP exon 2 GCTGGACGGGCAGTCTGTGA AGG CHIP exon 3 GAATCGCGAAGAAGAAGCGC TGG

    Article Title: Generation of two SPAST knockout human induced pluripotent stem cell lines to create a model for Hereditary Spastic Paraplegia type 4.
    Article Snippet: Antibodies and stains used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 Mouse anti-TRA1-81 1:100 1:500 Proteintech AB_2167545 Millipore AB_177638 Differentiation Markers Mouse anti-SMA Goat anti-SOX17 Rabbit anti-FOXA2 Mouse anti-TUJ 1:100 1:250 1:300 1:1000 Dako, AB_2223500 R&D Systems, AB_355060 Millipore, AB_390153 Sigma Aldrich, AB_477590 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG Alexa Fluor 488 Goat anti-Rabbit IgG Alexa Fluor 488 Donkey anti-Goat IgG Alexa Fluor 568 Mouse anti-Rabbit IgG 1:1000 1:1000 1:1000 1:1000 Life Technologies Life Technologies Life Technologies Life Technologies Nuclear stain DAPI 1 μg/ml ThermoFisher Scientific cat #D1306 Site-specific nuclease Nuclease information Alt-RTM S.p.

    Sequencing:

    Article Title: Generation of a homozygous CRISPR/Cas9-mediated knockout human iPSC line for the STUB1 locus.
    Article Snippet: Antibodies used for immunocytochemistry and Western Blotting Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 1:100 Proteintech, AB_2167545 Millipore, AB_177638 Mouse anti-TRA1–81 1:500 In vitro Differentiation Mouse anti-SMA 1:100 Dako, AB_2223500 R&D Systems, AB_355060 goat anti-SOX17 1:250 rabbit anti-FOX-A2 1:300 Millipore, AB_390153 Sigma Aldrich, AB_477590 mouse anti-TUJ 1:1000 Western Blotting Rabbit anti-CHIP 1:10.000 Abcam, AB_2751008 Meridian Life Science, AB_151542 Mouse anti-GAPDH 1:10.000 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG 1:1000 Life Technologies Alexa Fluor 488 Goat anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 488 Donkey anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 568 Donkey anti-Goat IgG 1:1000 Life Technologies Peroxidase-conjugated AffiniPure goat anti mouse 1:10.000 Jackson ImmunoResearch Peroxidase-conjugated AffiniPure goat anti-rabbit 1:10.000 Jackson ImmunoResearch Primers Target Forward primer Reverse primer (5′-3′) Episomal Plasmids KLF4 CCACCTCGCCTTACACATGAAG TAGCGTAAAAGGAGCAACATAG L-MYC GGCTGAGAAGAGGATGGCTAC TTTGTTTGACAGGAGCGACAAT OCT3/4 CATTCAAACTGAGGTAAGGG TAGCGTAAAAGGAGCAACATAG SOX2 TTCACATGTCCCAGCACTACCAG TTTGTTTGACAGGAGCGACAAT Pluripotency Markers (qPCR) c-MYC GACTCTGAGGAGGAACAAGA TGATCCAGACTCTGACCTTT DNMT3B GAGTATCAGGATGGGAAGGA ATAGCCTGTCGCTTGGA KLF4 CCATCTTTCTCCACGTTCGC CGTTGAACTCCTCGGTCTCT NANOG CAAAGGCAAACAACCCACTT TGCGTCACACCATTGCTATT OCT4 GGAAGGTATTCAGCCAAACG CTCCAGGTTGCCTCTCACTC SOX2 TGATGGAGACGGAGCTGAAG GCTTGCTGATCTCCGAGTTG TDGF1 GGTCTGTGCCCCATGACA AGTTCTGGAGTCCTGGAAGC Housekeeping Gene (qPCR) GAPDH AGGTCGGAGTCAACGGATTT ATCTCGCTCCTGGAAGATGG Targeted sequencing of CHIP KO CHIP TGATTCTAGCCAGAGCGCAG TCGGGAGTCGGTGATTCAGA CRISPR Guide RNAs Target Sequence PAM Sequence crRNAs CHIP exon 2 GCTGGACGGGCAGTCTGTGA AGG CHIP exon 3 GAATCGCGAAGAAGAAGCGC TGG

    Article Title: Generation of two SPAST knockout human induced pluripotent stem cell lines to create a model for Hereditary Spastic Paraplegia type 4.
    Article Snippet: Antibodies and stains used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 Mouse anti-TRA1-81 1:100 1:500 Proteintech AB_2167545 Millipore AB_177638 Differentiation Markers Mouse anti-SMA Goat anti-SOX17 Rabbit anti-FOXA2 Mouse anti-TUJ 1:100 1:250 1:300 1:1000 Dako, AB_2223500 R&D Systems, AB_355060 Millipore, AB_390153 Sigma Aldrich, AB_477590 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG Alexa Fluor 488 Goat anti-Rabbit IgG Alexa Fluor 488 Donkey anti-Goat IgG Alexa Fluor 568 Mouse anti-Rabbit IgG 1:1000 1:1000 1:1000 1:1000 Life Technologies Life Technologies Life Technologies Life Technologies Nuclear stain DAPI 1 μg/ml ThermoFisher Scientific cat #D1306 Site-specific nuclease Nuclease information Alt-RTM S.p.

    CRISPR:

    Article Title: Generation of a homozygous CRISPR/Cas9-mediated knockout human iPSC line for the STUB1 locus.
    Article Snippet: Antibodies used for immunocytochemistry and Western Blotting Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 1:100 Proteintech, AB_2167545 Millipore, AB_177638 Mouse anti-TRA1–81 1:500 In vitro Differentiation Mouse anti-SMA 1:100 Dako, AB_2223500 R&D Systems, AB_355060 goat anti-SOX17 1:250 rabbit anti-FOX-A2 1:300 Millipore, AB_390153 Sigma Aldrich, AB_477590 mouse anti-TUJ 1:1000 Western Blotting Rabbit anti-CHIP 1:10.000 Abcam, AB_2751008 Meridian Life Science, AB_151542 Mouse anti-GAPDH 1:10.000 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG 1:1000 Life Technologies Alexa Fluor 488 Goat anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 488 Donkey anti-Rabbit IgG 1:1000 Life Technologies Alexa Fluor 568 Donkey anti-Goat IgG 1:1000 Life Technologies Peroxidase-conjugated AffiniPure goat anti mouse 1:10.000 Jackson ImmunoResearch Peroxidase-conjugated AffiniPure goat anti-rabbit 1:10.000 Jackson ImmunoResearch Primers Target Forward primer Reverse primer (5′-3′) Episomal Plasmids KLF4 CCACCTCGCCTTACACATGAAG TAGCGTAAAAGGAGCAACATAG L-MYC GGCTGAGAAGAGGATGGCTAC TTTGTTTGACAGGAGCGACAAT OCT3/4 CATTCAAACTGAGGTAAGGG TAGCGTAAAAGGAGCAACATAG SOX2 TTCACATGTCCCAGCACTACCAG TTTGTTTGACAGGAGCGACAAT Pluripotency Markers (qPCR) c-MYC GACTCTGAGGAGGAACAAGA TGATCCAGACTCTGACCTTT DNMT3B GAGTATCAGGATGGGAAGGA ATAGCCTGTCGCTTGGA KLF4 CCATCTTTCTCCACGTTCGC CGTTGAACTCCTCGGTCTCT NANOG CAAAGGCAAACAACCCACTT TGCGTCACACCATTGCTATT OCT4 GGAAGGTATTCAGCCAAACG CTCCAGGTTGCCTCTCACTC SOX2 TGATGGAGACGGAGCTGAAG GCTTGCTGATCTCCGAGTTG TDGF1 GGTCTGTGCCCCATGACA AGTTCTGGAGTCCTGGAAGC Housekeeping Gene (qPCR) GAPDH AGGTCGGAGTCAACGGATTT ATCTCGCTCCTGGAAGATGG Targeted sequencing of CHIP KO CHIP TGATTCTAGCCAGAGCGCAG TCGGGAGTCGGTGATTCAGA CRISPR Guide RNAs Target Sequence PAM Sequence crRNAs CHIP exon 2 GCTGGACGGGCAGTCTGTGA AGG CHIP exon 3 GAATCGCGAAGAAGAAGCGC TGG

    Article Title: Generation of two SPAST knockout human induced pluripotent stem cell lines to create a model for Hereditary Spastic Paraplegia type 4.
    Article Snippet: Antibodies and stains used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-OCT4 Mouse anti-TRA1-81 1:100 1:500 Proteintech AB_2167545 Millipore AB_177638 Differentiation Markers Mouse anti-SMA Goat anti-SOX17 Rabbit anti-FOXA2 Mouse anti-TUJ 1:100 1:250 1:300 1:1000 Dako, AB_2223500 R&D Systems, AB_355060 Millipore, AB_390153 Sigma Aldrich, AB_477590 Secondary antibodies Alexa Fluor 488 Goat anti-Mouse IgG Alexa Fluor 488 Goat anti-Rabbit IgG Alexa Fluor 488 Donkey anti-Goat IgG Alexa Fluor 568 Mouse anti-Rabbit IgG 1:1000 1:1000 1:1000 1:1000 Life Technologies Life Technologies Life Technologies Life Technologies Nuclear stain DAPI 1 μg/ml ThermoFisher Scientific cat #D1306 Site-specific nuclease Nuclease information Alt-RTM S.p.



    Similar Products

    96
    Cell Signaling Technology Inc oct4
    Oct4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti-oct4/Oct-4A+Rabbit+mAb/pm41932553-106-9-11
    Average 96 stars, based on 1 article reviews
    oct4 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    Cell Signaling Technology Inc anti oct4 antibody
    Anti Oct4 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti-oct4/Oct-4A+Rabbit+mAb/pmc13006416-47-0-3
    Average 95 stars, based on 1 article reviews
    anti oct4 antibody - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    94
    Proteintech rabbit anti oct4
    Rabbit Anti Oct4, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti-oct4/HRP-conjugated+OCT4+Antibody/pm41814669-88-35-37
    Average 94 stars, based on 1 article reviews
    rabbit anti oct4 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc rrid pluripotency undifferentiation markers rabbit anti oct4
    Rrid Pluripotency Undifferentiation Markers Rabbit Anti Oct4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti-oct4/Oct-4+Antibody/pm41833207-55-9-16
    Average 96 stars, based on 1 article reviews
    rrid pluripotency undifferentiation markers rabbit anti oct4 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc anti oct4
    Anti Oct4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti-oct4/Nanog+XP+Rabbit+mAb/10__1158_slash_0008___5472__can___25___3520-55-48-49
    Average 96 stars, based on 1 article reviews
    anti oct4 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc mouse anti oct4 c30a3
    Mouse Anti Oct4 C30a3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti-oct4/Oct-4A+Rabbit+mAb/pmc12946742-3-0-4
    Average 96 stars, based on 1 article reviews
    mouse anti oct4 c30a3 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    94
    Novus Biologicals rabbit polyclonal oct4
    Synergistic induction of advanced neural stem cells (ANSCs) from PSCs by TTNPB and CHIR99021. (A), Schematic of the generation of advanced neural stem cells (ANSCs) from pluripotent stem cells (PSCs). (B), Morphology and alkaline phosphatase staining of PSCs (passage 20) and ANSCs (passage 50). Scale bar: 100 µm. (C), Immunofluorescence staining of pluripotency markers ( <t>OCT4,</t> SOX2, NANOG ) and lineage markers ( SOX17, TBXT, PAX6 ) of PSCs and ANSCs. Scale bar: 50 µm. (D), Volcano plot showing differentially expressed genes (DEGs) between ANSCs and PSCs (|log 2 FC| > 1, P < 0.05). (E), Heatmap illustrating the expression levels of pluripotency genes, neuroectodermal genes, genes associated with retinoic acid (RA) signaling, and downstream target genes of the RA signaling pathway in ANSCs and PSCs. (F), Hierarchical clustering of transcriptomic profiles from PSCs, NSCs, and ANSCs (distance metric: 1‐ Spearman correlation coefficient). (G), Schematic and morphology on day 9 of ANSCs during spontaneous differentiation in N2B27 medium. Scale bar: 100 µm. (H), RT‐qPCR analysis of SOX2, SOX1, SOX10, HOXA1, PAX6, TUBB3 , and NESTIN expression in ANSCs before (Day 0) and after spontaneous differentiation (Day 9). Data were normalized to GAPDH . Error bars represent mean ± SD. (n = 3 biological replicates). P values were determined using two‐tailed Student's t ‐tests. (I), Representative images of mouse 8‐cell embryos at 24 and 48 h post‐injection with ANSCs or PSCs. Yellow arrows indicate the injected cells carrying the tdTomato fluorescent protein. Scale bar: 100 µm. (J), Cell counts of ANSCs and PSCs contributing to mouse embryos were performed separately. (K), Representative images of ANSCs treated with TTNPB alone (CHIR99021 withdrawal). T: TTNPB; CHIR: CHIR99021. Scale bars: 100 µm. (L), Representative images of NSCs treated with LIF alone (CHIR99021 withdrawal). L: LIF (leukemia inhibitory factor). Scale bars: 100 µm. (M), Representative images of NSCs treated with CHIR99021 alone (LIF withdrawal). C: CHIR99021. Scale bars: 100 µm.
    Rabbit Polyclonal Oct4, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti-oct4/OCT4+Antibody/pmc13088305-282-5-8
    Average 94 stars, based on 1 article reviews
    rabbit polyclonal oct4 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    Synergistic induction of advanced neural stem cells (ANSCs) from PSCs by TTNPB and CHIR99021. (A), Schematic of the generation of advanced neural stem cells (ANSCs) from pluripotent stem cells (PSCs). (B), Morphology and alkaline phosphatase staining of PSCs (passage 20) and ANSCs (passage 50). Scale bar: 100 µm. (C), Immunofluorescence staining of pluripotency markers ( OCT4, SOX2, NANOG ) and lineage markers ( SOX17, TBXT, PAX6 ) of PSCs and ANSCs. Scale bar: 50 µm. (D), Volcano plot showing differentially expressed genes (DEGs) between ANSCs and PSCs (|log 2 FC| > 1, P < 0.05). (E), Heatmap illustrating the expression levels of pluripotency genes, neuroectodermal genes, genes associated with retinoic acid (RA) signaling, and downstream target genes of the RA signaling pathway in ANSCs and PSCs. (F), Hierarchical clustering of transcriptomic profiles from PSCs, NSCs, and ANSCs (distance metric: 1‐ Spearman correlation coefficient). (G), Schematic and morphology on day 9 of ANSCs during spontaneous differentiation in N2B27 medium. Scale bar: 100 µm. (H), RT‐qPCR analysis of SOX2, SOX1, SOX10, HOXA1, PAX6, TUBB3 , and NESTIN expression in ANSCs before (Day 0) and after spontaneous differentiation (Day 9). Data were normalized to GAPDH . Error bars represent mean ± SD. (n = 3 biological replicates). P values were determined using two‐tailed Student's t ‐tests. (I), Representative images of mouse 8‐cell embryos at 24 and 48 h post‐injection with ANSCs or PSCs. Yellow arrows indicate the injected cells carrying the tdTomato fluorescent protein. Scale bar: 100 µm. (J), Cell counts of ANSCs and PSCs contributing to mouse embryos were performed separately. (K), Representative images of ANSCs treated with TTNPB alone (CHIR99021 withdrawal). T: TTNPB; CHIR: CHIR99021. Scale bars: 100 µm. (L), Representative images of NSCs treated with LIF alone (CHIR99021 withdrawal). L: LIF (leukemia inhibitory factor). Scale bars: 100 µm. (M), Representative images of NSCs treated with CHIR99021 alone (LIF withdrawal). C: CHIR99021. Scale bars: 100 µm.

    Journal: Advanced Science

    Article Title: TTNPB Promotes Human Pluripotent Stem Cell‐to‐Neural Stem Cell Transition via Modulation of Chromatin Accessibility and the S‐(5′‐adenosyl)‐L‐homocysteine/Choline Metabolic Network

    doi: 10.1002/advs.202515648

    Figure Lengend Snippet: Synergistic induction of advanced neural stem cells (ANSCs) from PSCs by TTNPB and CHIR99021. (A), Schematic of the generation of advanced neural stem cells (ANSCs) from pluripotent stem cells (PSCs). (B), Morphology and alkaline phosphatase staining of PSCs (passage 20) and ANSCs (passage 50). Scale bar: 100 µm. (C), Immunofluorescence staining of pluripotency markers ( OCT4, SOX2, NANOG ) and lineage markers ( SOX17, TBXT, PAX6 ) of PSCs and ANSCs. Scale bar: 50 µm. (D), Volcano plot showing differentially expressed genes (DEGs) between ANSCs and PSCs (|log 2 FC| > 1, P < 0.05). (E), Heatmap illustrating the expression levels of pluripotency genes, neuroectodermal genes, genes associated with retinoic acid (RA) signaling, and downstream target genes of the RA signaling pathway in ANSCs and PSCs. (F), Hierarchical clustering of transcriptomic profiles from PSCs, NSCs, and ANSCs (distance metric: 1‐ Spearman correlation coefficient). (G), Schematic and morphology on day 9 of ANSCs during spontaneous differentiation in N2B27 medium. Scale bar: 100 µm. (H), RT‐qPCR analysis of SOX2, SOX1, SOX10, HOXA1, PAX6, TUBB3 , and NESTIN expression in ANSCs before (Day 0) and after spontaneous differentiation (Day 9). Data were normalized to GAPDH . Error bars represent mean ± SD. (n = 3 biological replicates). P values were determined using two‐tailed Student's t ‐tests. (I), Representative images of mouse 8‐cell embryos at 24 and 48 h post‐injection with ANSCs or PSCs. Yellow arrows indicate the injected cells carrying the tdTomato fluorescent protein. Scale bar: 100 µm. (J), Cell counts of ANSCs and PSCs contributing to mouse embryos were performed separately. (K), Representative images of ANSCs treated with TTNPB alone (CHIR99021 withdrawal). T: TTNPB; CHIR: CHIR99021. Scale bars: 100 µm. (L), Representative images of NSCs treated with LIF alone (CHIR99021 withdrawal). L: LIF (leukemia inhibitory factor). Scale bars: 100 µm. (M), Representative images of NSCs treated with CHIR99021 alone (LIF withdrawal). C: CHIR99021. Scale bars: 100 µm.

    Article Snippet: The primary antibodies used included: rabbit polyclonal OCT4 (Novus Biologicals, #NBP2‐15053, 1:200), rabbit polyclonal NANOG (PeproTech, #P236, 1:200), goat polyclonal SOX2 (R&D Systems, #AF2018, 1:200), rabbit monoclonal NESTIN (Boster, #PB9874, 1:200), rabbit polyclonal PAX6 (Elabscience, #E‐AB‐61653, 1:200), rabbit polyclonal N‐Cadherin (Abcam, #ab76057, 1:200), goat polyclonal Brachyury (R&D Systems, #AF2085, 1:100), goat polyclonal SOX17 (R&D Systems, #AF1924, 1:200), mouse monoclonal NeuN (CST, #93972, 1:100), mouse monoclonal TUBB3 (Bioss, #BSM‐33177M, 1:200), rabbit polyclonal GFAP (Bioss, #bs‐0199R, 1:200), and rabbit monoclonal CDX2 (Biogenex, #Cdx2‐88).

    Techniques: Staining, Immunofluorescence, Expressing, Quantitative RT-PCR, Two Tailed Test, Injection